opuBA [2019-04-24 13:20:42]

choline and arsenocholine ABC transporter (ATP-binding protein)

Locus: BSU33730

Isoelectric point: 5.65

Molecular weight: 42.92 kDa

Protein length: 381 aa

Gene length: 1146 bp

Function: compatible solute transport

Product: choline and arsenocholine ABC transporter (ATP-binding protein)

Essential: no

Synonyms: proV

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of compatible solutes for osmoprotection
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,462,105 3,463,250

The protein

Catalyzed reaction/ biological activity

• uptake of choline and arsenocholine PubMed

Protein family

• ABC transporter family (according to Swiss-Prot)

Paralogous protein(s)

• MsmX, OpuCA, OpuAA

Domains

• 2 CBS domains (256-314, 316-374)

Structure

• 2IT1 (from Pyrococcus horikoshii, 43% identity)

Localization

• associated to the membrane (via OpuBB-OpuBD) PubMed

Expression and Regulation

Operons

• Genes: opuBA-opuBB-opuBC-opuBD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GbsR: repression, (transcriptional roadblock) PubMed, in GbsR regulon
  • OpcR: repression, (sterical interference with RNA polymerase access) PubMed, in OpcR regulon
  • RemA: activation, PubMed, in RemA regulon

  Regulation

  • induced by choline (GbsR) PubMed
  • expression increases with increasing salinity PubMed

  Additional information

  • S1290 acts as antisense RNA for the opuBA-opuBB-opuBC-opuBD operon PubMed
  • expression starts with a delay after osmotic upshift due to transcriptional interference of RNA polymerase complexes driving synthesis of the converging opuB and S1290 mRNAs PubMed

Biological materials

Mutant

• BKE33730 (opuBA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAACATCGCACCTCCAAAA, downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA
• BKK33730 (opuBA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAACATCGCACCTCCAAAA, downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA

Expression vectors

• pGP2938: (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP3013: (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading